View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9255_low_5 (Length: 279)
Name: NF9255_low_5
Description: NF9255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9255_low_5 |
 | |
|
| [»] scaffold0512 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 15 - 260
Target Start/End: Original strand, 48418011 - 48418256
Alignment:
| Q |
15 |
ttttggtaattcaagataatcaagtaaacaagagaatgcttctgatcacgggtgatgatacctctccttgcttcaaaaatcttttgaatcaagtggtttc |
114 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48418011 |
ttttggtaattcgagataatcaagtaaacaagagaatgcttctgatcacgggtgatgatacctctccttgcttcaaaaatcttttgaatcaagtggtttc |
48418110 |
T |
|
| Q |
115 |
cataagggtgtgtcatgagcatgtgtaaagaatccttcacttcatagaggattagggcaacatctgttgggttgcccactctgatcttctgttgtatata |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
48418111 |
cataagggtgtgtcatgagcatgtgtaaagaatccttcacttcatagaggattagcgcaacatctgttgggttgcccattctgatcttctgttgtatata |
48418210 |
T |
|
| Q |
215 |
tcgacaatcacgtcgattcatcgccattgaaaccaacgaccctcta |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48418211 |
tcgacaatcacgtcgattcatcgccattgaaaccaacgaccctcta |
48418256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 72 - 166
Target Start/End: Complemental strand, 729911 - 729817
Alignment:
| Q |
72 |
atacctctccttgcttcaaaaatcttttgaatcaagtggtttccataagggtgtgtcatgagcatgtgtaaagaatccttcacttcatagaggat |
166 |
Q |
| |
|
||||| |||||||||| |||||||||||||||||| | | | ||| || | |||||||||||| |||||| ||||||||||||| ||||||| |
|
|
| T |
729911 |
atacccctccttgcttgaaaaatcttttgaatcaaatagctgccaaaacgatgtgtcatgagctcatgtaaataatccttcacttctaagaggat |
729817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0512 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0512
Description:
Target: scaffold0512; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 89 - 130
Target Start/End: Complemental strand, 2406 - 2365
Alignment:
| Q |
89 |
aaaaatcttttgaatcaagtggtttccataagggtgtgtcat |
130 |
Q |
| |
|
|||||||||||||||||||| ||| ||| ||||||||||||| |
|
|
| T |
2406 |
aaaaatcttttgaatcaagtagttgccaaaagggtgtgtcat |
2365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University