View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9256_low_7 (Length: 314)
Name: NF9256_low_7
Description: NF9256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9256_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 4e-81; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 127 - 295
Target Start/End: Complemental strand, 22128225 - 22128057
Alignment:
| Q |
127 |
gtggtttcaattcgtgggacaaaccagttcaaaaacctgagttatttacttgaatatttcattgaccaatagaggagataaagatgaaggggtaattggg |
226 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
22128225 |
gtggtttcaattcgtgggacaaaccacttcaaaaacctgagttatttacttgaatatttcattgaccaatagaggagataaagatgaaagggtaattggg |
22128126 |
T |
|
| Q |
227 |
aaagtaaaagacattaaaattgagtgaaagagtgtagcaagcctacggtacgatgtaactagtctcaga |
295 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
22128125 |
aaagtgaaagacattaaaattgagtgaaagagtgtagcaagcctacggtgcgatgtaactagtctcaga |
22128057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 22128518 - 22128481
Alignment:
| Q |
1 |
aacactcattggagaagataaaattaaacctaatgttg |
38 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22128518 |
aacactcattggagaagataaaattaaacctaatgttg |
22128481 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University