View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9257_high_2 (Length: 240)
Name: NF9257_high_2
Description: NF9257
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9257_high_2 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 87; Significance: 8e-42; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 100 - 224
Target Start/End: Original strand, 33675238 - 33675351
Alignment:
| Q |
100 |
tggtgctaatgaattgtgtttctaatgtgtccttttcagttttgtgaagtttttgtatattctcaattgttttttgcatatggcaatctcatctttttta |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
33675238 |
tggtgctaatgaattgtgtttctaatgtgtccttttcagttttgtgaagtttttgtatattctcaattgttttttgca-----------catctttttta |
33675326 |
T |
 |
| Q |
200 |
gagctaaccagtcacacatgctatc |
224 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
33675327 |
gagctaaccagtcacacatgctatc |
33675351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 6 - 57
Target Start/End: Original strand, 33664742 - 33664793
Alignment:
| Q |
6 |
agagattagctataagaaatatatgaagaaataatgtatgttacattaatat |
57 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
33664742 |
agagattagttataagaaatatatgaagaagaaatgtatgttatattaatat |
33664793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 6 - 57
Target Start/End: Original strand, 33686544 - 33686595
Alignment:
| Q |
6 |
agagattagctataagaaatatatgaagaaataatgtatgttacattaatat |
57 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
33686544 |
agagattagttataagaaatatatgaagaagaaatgtatgttatattaatat |
33686595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 106 - 144
Target Start/End: Original strand, 33665185 - 33665223
Alignment:
| Q |
106 |
taatgaattgtgtttctaatgtgtccttttcagttttgt |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
33665185 |
taatgaattgtgtttctaatgtgtccttttctgttttgt |
33665223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University