View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9258_high_12 (Length: 279)
Name: NF9258_high_12
Description: NF9258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9258_high_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 12 - 232
Target Start/End: Complemental strand, 41592310 - 41592083
Alignment:
| Q |
12 |
agcagagaaaacacagatcagatatagagaaatgaatatttgccatggtcaccaacagagccatgttcacacctgatgtgtcaccacgctgcacacacgt |
111 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41592310 |
agcagagaaaacacagatcagatacagagaaatgaatatctgccatggtcaccaacagagccatgttcacacctgatgtgtcaccacgctgcacacacgt |
41592211 |
T |
|
| Q |
112 |
gaacgttgtagcggagccttaagaatatccatcactcggacacacatgttaggctcaaaactgag-------cattttgtttttcataaatacaagtgtc |
204 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
41592210 |
gaacgttgtagctgagccttaagaatatccatcactcggacacacatgttaggctcaaaactgagcattctgcattttgtttttcataaatacaagtgtc |
41592111 |
T |
|
| Q |
205 |
tatagcgaccgaaggcctagggcaatga |
232 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
41592110 |
tatagcgaccgaaggcctagggcaatga |
41592083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University