View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9258_high_16 (Length: 242)
Name: NF9258_high_16
Description: NF9258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9258_high_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 1 - 177
Target Start/End: Original strand, 54606368 - 54606544
Alignment:
| Q |
1 |
tacaagtagattagagttgaagtcaaaccagaatataaaaggttcaatgtttgagatacaggatgctttttcattgttttgcgagacaattcatgtatgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| ||| |||| ||||||||||| |||||| |
|
|
| T |
54606368 |
tacaagtagattagagttgaagtcaaaccataatataaaaggttcaatgtttgagatacaggatgccttttcgttgctttgtgagacaattcacgtatgc |
54606467 |
T |
|
| Q |
101 |
aatgattaacagttttaaacaagaaatgtggatttccatttcttttcttgggaaccaaaggaaatttggataatgct |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
54606468 |
aatgattaacagttttaaacaagaaatgtggatttccatttcttttcttcggaaccaaaggaaatttggataatgct |
54606544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University