View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9258_high_17 (Length: 205)
Name: NF9258_high_17
Description: NF9258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9258_high_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 7e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 7e-88
Query Start/End: Original strand, 24 - 191
Target Start/End: Complemental strand, 29502584 - 29502417
Alignment:
| Q |
24 |
gtttgtactttcatgagcaaaacatgattaattctaaacttctacaataattctattgacttaaaattgacattttttgcttggcacatagaaataccaa |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29502584 |
gtttgtactttcatgagcaaaacatgattaattctaaacttctacaataattctattgagttaaaattgacattttttgcttggcacatagaaataccaa |
29502485 |
T |
 |
| Q |
124 |
atataaacgagttaaacatattactattgttgttgttatatttgtagcagtaataacaggagtattat |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29502484 |
atataaacgagttaaacatattactattgttgttgttatatttgtagcagtaataacaggagtattat |
29502417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University