View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9258_low_30 (Length: 262)

Name: NF9258_low_30
Description: NF9258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9258_low_30
NF9258_low_30
[»] chr4 (1 HSPs)
chr4 (144-218)||(54607192-54607266)


Alignment Details
Target: chr4 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 144 - 218
Target Start/End: Original strand, 54607192 - 54607266
Alignment:
144 ttgttaaaacttgtaagactataaccgtgagtagttgacattgcctcatattatacatataagcaaactcactca 218  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
54607192 ttgttaaaacttgtaagactataactgtgagtagttgacattgcctcatattatacatataagcaaactcactca 54607266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University