View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9259_low_19 (Length: 241)
Name: NF9259_low_19
Description: NF9259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9259_low_19 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 28 - 241
Target Start/End: Complemental strand, 36754137 - 36753925
Alignment:
| Q |
28 |
tagaaagtgagtgtggtagatgaaaaagacaccccaattcaccactaatttttgcagcaagttttgatgggaaaatccattttctctcctcttacttcta |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36754137 |
tagaaagtgagtgtggtagatgaaaaagacaccccaattcaccactaatttttgcagcgggttttgatgggaaaatccattttctctcctcttacttcta |
36754038 |
T |
 |
| Q |
128 |
taattttcttatttagcataattgtgatgcccaaatggatgataaaaagaaatcatgaggtccaaatttgtggaaacgagtcataataactcatgctact |
227 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36754037 |
taattttcttattta-cataattgtgatgcccaaatggatgataaaaagaaatcatgaggtccaaatttgtggaaacgagtcataataactcatgctact |
36753939 |
T |
 |
| Q |
228 |
tgtaacaacaaatt |
241 |
Q |
| |
|
||||||||||||| |
|
|
| T |
36753938 |
agtaacaacaaatt |
36753925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University