View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9259_low_6 (Length: 445)
Name: NF9259_low_6
Description: NF9259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9259_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 73; Significance: 3e-33; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 358 - 430
Target Start/End: Original strand, 10419767 - 10419839
Alignment:
| Q |
358 |
tttagaaaaatattgtcaccaaatttatacaagttcactaaagatgtgataaatgttgtataaacaaaggaca |
430 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10419767 |
tttagaaaaatattgtcaccaaatttatacaagttcactaaagatgtgataaatgttgtataaacaaaggaca |
10419839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University