View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9259_low_7 (Length: 445)

Name: NF9259_low_7
Description: NF9259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9259_low_7
NF9259_low_7
[»] chr4 (1 HSPs)
chr4 (358-430)||(10419767-10419839)


Alignment Details
Target: chr4 (Bit Score: 73; Significance: 3e-33; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 358 - 430
Target Start/End: Original strand, 10419767 - 10419839
Alignment:
358 tttagaaaaatattgtcaccaaatttatacaagttcactaaagatgtgataaatgttgtataaacaaaggaca 430  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10419767 tttagaaaaatattgtcaccaaatttatacaagttcactaaagatgtgataaatgttgtataaacaaaggaca 10419839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University