View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9261_low_38 (Length: 383)
Name: NF9261_low_38
Description: NF9261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9261_low_38 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 19 - 317
Target Start/End: Original strand, 39006035 - 39006333
Alignment:
| Q |
19 |
atctcgacgagggtgttaagaggattgttgaaacgattgatgggttggatgttggggttttgattaacaacgttgggatttcgtatccttatgcgagatt |
118 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
39006035 |
atctcgacgacggtgttaagaggattgttgaaacgattgatgggttggatgttggggttttgattaacaacgtggggatttcgtatccttatgcgagatt |
39006134 |
T |
 |
| Q |
119 |
tttccatgaagttgatcaagagcttttgaagaatttgattaaggttaatgttgttggaactactaaggttactcaagctgttttgcctgggatgttgaag |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39006135 |
tttccatgaagttgatcaagagcttttgaagaatttgattaaggttaatgttgttggaactactaaggttactcaagctgttttgcctgggatgttgaag |
39006234 |
T |
 |
| Q |
219 |
aggaaaaagggtgctattgttaatattggttctggtgctgctattgttattccttctgatcctctttatgctgtttatgctgctacaaaagcgtgagct |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39006235 |
aggaaaaagggtgctattgttaatattggttctggtgctgctattgttattccttctgatcctctttatgctgtttatgctgctacaaaagcgtgagct |
39006333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University