View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9261_low_52 (Length: 293)
Name: NF9261_low_52
Description: NF9261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9261_low_52 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 240; Significance: 1e-133; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 21 - 275
Target Start/End: Original strand, 3469496 - 3469751
Alignment:
| Q |
21 |
aaagaataag-aacgaacctggcattgggttgaatatgtcgaacgagagatgaacggtcgtctgcaagaagaatcgaaactggagaccgaagagctgcgg |
119 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3469496 |
aaagaataaggaacgaacctggcattgggttgaatatgtcgaacgagagatgaacggtcgtctgcaagaagaatcggaactggagaccgaagagctgcgg |
3469595 |
T |
|
| Q |
120 |
ccggggaagagagattctccggtttgcaaaggaaacaaataatatcgaccatgcaaacttttccgatacatttgcaatgaaattcaaagtcctctttgat |
219 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3469596 |
ccggggaagagagattctccggtctgcaaaggaaacaaataatatcgaccatgcaaacttttccgatacatttgcaatgaaattcaaagtcctctttgat |
3469695 |
T |
|
| Q |
220 |
tagggtttgaggaggttttctgttgatggaatggtgacaattccaaacgctgatgt |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3469696 |
tagggtttgaggaggttttctgttgatggaatggtgacaattccaaacgctgatgt |
3469751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 131 - 180
Target Start/End: Original strand, 33554729 - 33554778
Alignment:
| Q |
131 |
agattctccggtttgcaaaggaaacaaataatatcgaccatgcaaacttt |
180 |
Q |
| |
|
||||| || |||||||||||| ||||||||| ||| |||||||||||||| |
|
|
| T |
33554729 |
agattttctggtttgcaaaggtaacaaataacatcaaccatgcaaacttt |
33554778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University