View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9261_low_56 (Length: 277)
Name: NF9261_low_56
Description: NF9261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9261_low_56 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 31 - 263
Target Start/End: Original strand, 32726617 - 32726849
Alignment:
| Q |
31 |
atagatggactgagctgttcgaggacagttgttctgtcctcgatgatggtgtccatgaggaggtgaaagtcatctggggcacctgtaaaggtgtcccagt |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32726617 |
atagatggactgagctgttcgaggacagttgttctgtcctcgatgatggtgtccatgaggtggtgaaagtcatctggggcacctgtaaaggtgtcccagt |
32726716 |
T |
 |
| Q |
131 |
tgacgatgggagaccagtggttccaggtgcaaccataatcatcgtcggaagtaggggtgttggtgagggagctgtgtccagagaagtggaggtcattgat |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32726717 |
tgacgatgggagaccagtggttccaggtgcaaccataatcctcgtcggaagtaggggtgttggtgagggagctgtgtccagagaagtggaggtcattgat |
32726816 |
T |
 |
| Q |
231 |
ggcatccatgtccatcaaatccatggtataatt |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
32726817 |
ggcatccatgtccatcaaatccatggtataatt |
32726849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University