View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9261_low_60 (Length: 253)
Name: NF9261_low_60
Description: NF9261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9261_low_60 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 8 - 253
Target Start/End: Original strand, 22318476 - 22318715
Alignment:
| Q |
8 |
gagcagagatagctataaacgttaaataaataagcactcgaatagtttcgtaagtgttttgatcataagataaacacatttacgttgtaaatgatgcatt |
107 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
22318476 |
gagctgagatagctataaacgttaa-----taagcactcgaatagtttcgtaagtgttttgatcataagataaacacatttatgttgtaaatgatgcatt |
22318570 |
T |
 |
| Q |
108 |
ccaaagtctatatgggtaactttctagaacttgattannnnnnngttgttgtcaaccttccgatttatgaagaaaaggggttttgataatctagaattcc |
207 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
22318571 |
ctaaagtctatatgggtaactttctagaacttgattatttttttgttgttgtcaaccttccgatttatgaag-aaaggggttttgataatccagaattcc |
22318669 |
T |
 |
| Q |
208 |
accgtgatgattatagcataatcaagaacgattacacacatgaatc |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22318670 |
accgtgatgattatagcataatcaagaacgattacacacatgaatc |
22318715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University