View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9261_low_64 (Length: 239)
Name: NF9261_low_64
Description: NF9261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9261_low_64 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 22318701 - 22318917
Alignment:
| Q |
1 |
ttacacacatgaatcaaaatcaggttctccaaatagttctttctttggtaaaactcgttaagtacaatcaccttattattcagaacttgaactcgataag |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| |||||||||||| |||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
22318701 |
ttacacacatgaatcaaaatcagattctccaaatagtt------ttggtaaaactcattaagtacaatcaccttattatctagaacttgaactcgataag |
22318794 |
T |
 |
| Q |
101 |
ctctaaaagttatttataggttcaggagtttttcttttccaactttcacttgcgaaattgcatccctaccttgtctatggaaatggcacatcaattccct |
200 |
Q |
| |
|
|||||||||||||| ||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22318795 |
ctctaaaagttattcataggttcatgcgtttttcttttccaactttcacttgcgaaattgcatccctaccttgtctatggaaatggcacatcaattccct |
22318894 |
T |
 |
| Q |
201 |
aaaccgattgtccacatcaaatg |
223 |
Q |
| |
|
||||| ||| ||||||||||||| |
|
|
| T |
22318895 |
aaaccaattctccacatcaaatg |
22318917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University