View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9262_high_25 (Length: 320)
Name: NF9262_high_25
Description: NF9262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9262_high_25 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 15 - 320
Target Start/End: Complemental strand, 43654885 - 43654580
Alignment:
| Q |
15 |
agacaaacagtttcgtgtttcctttctcatttcaccattccaatgtacactctctcgctactttctctctctaaaacaaagacatagaaccccctccaaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
43654885 |
agacaaacagtttcgtgtttcctttctcatttcaccattccaatgtacactctctcgctactttctctctctaaaataaagacatagaacccccaccaaa |
43654786 |
T |
 |
| Q |
115 |
ccaaaccttcatccttccaccagcatgcttgtaatgccacagccacccaaacccttcaacacaatcaccatcacaatcatgatagccttcaccttcttcc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43654785 |
ccaaaccttcatccttccaccagcatgcttgtaatgccacagccacccaaacccttcaacacaatcaccatcacaatcatgatagccttcaccttcttcc |
43654686 |
T |
 |
| Q |
215 |
tcctcttcctcaccggtttcctccaattcccttctatttcaccctctctcccgggccccatccacgcttccttcccgctcccttctaccaatacctcctc |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||| ||||||||||||| ||||||||||| |
|
|
| T |
43654685 |
tcctcttcctcaccggtttcctccaattcccttctatttcaccctctctcccgggtcccatccacgattccttcacgctcccttctacaaatacctcctc |
43654586 |
T |
 |
| Q |
315 |
caaacc |
320 |
Q |
| |
|
|||||| |
|
|
| T |
43654585 |
caaacc |
43654580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University