View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9262_high_31 (Length: 267)
Name: NF9262_high_31
Description: NF9262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9262_high_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 23 - 252
Target Start/End: Complemental strand, 7465641 - 7465412
Alignment:
| Q |
23 |
atatgccatagccagtgcctgagagtaatctttttgcaagccatccaatacttttgtatttcttctattccaaagactccataaaaccatgcaaaatgag |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7465641 |
atatgccatagccagtgcctgagagtaatctttttgcaagccatccaatacttttgtatttcttctattccaaagactccataaaaccatgcgaaatgag |
7465542 |
T |
 |
| Q |
123 |
gccaaaactccattatccagcaactgacagactttgaaaaacacctctgnnnnnnntggatgcacgtgccataatttggctgagtccgcccttgattccc |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7465541 |
gccaaaactccattatccagcaactgacagactttgaaaaacacctctgaaaaaaatggatgcacgtgccataatttgcctgagtccgcccttgattccc |
7465442 |
T |
 |
| Q |
223 |
atattctgctcacattcaacactgcacagg |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
7465441 |
atattctgctcacattcaacactgcacagg |
7465412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University