View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9262_low_43 (Length: 375)
Name: NF9262_low_43
Description: NF9262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9262_low_43 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 321; Significance: 0; HSPs: 6)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 5 - 361
Target Start/End: Complemental strand, 32710252 - 32709901
Alignment:
| Q |
5 |
gagaagcagagaaacaatagagcatatactaagaaagactgaaagaagaaacaaaagcaagaatgaaagtatcacaagtattgcacatgaatggaggtgt |
104 |
Q |
| |
|
|||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32710252 |
gagaagcaaaaaaacaatagagcatatactaagaaagactgaaagaagaaacaaaagcaagaatgaaagtatcacaagtattgcacatgaatggaggtgt |
32710153 |
T |
|
| Q |
105 |
tggagaagcaagctatgcaaacaactccttagttcaggtattttatacatgaattcatatttaacatatcatgtacgtgcatgtaaattgttttgtaatt |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32710152 |
tggagaagcaagctatgcaaacaactccttagttcaggtat-----acatgaattcatatttaacatatcatgtacgtgcatgtaaattgttttgtaatt |
32710058 |
T |
|
| Q |
205 |
gatgtaattggttttatatacagcaacaagtgttttctttgacaaagtccattagagaagaagccataactagtctctactgcagtgcatacccaaatag |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32710057 |
gatgtaattggttttatatacagcaacaagtgctttctttgacaaagtccattagagaagaagccataactagtctctactgcagtgcatacccaaatag |
32709958 |
T |
|
| Q |
305 |
cttagcaattgcagacttgggttgctcttctgggccaaacactttgtttgtggtatc |
361 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32709957 |
cttagcaattgcagacttgggttgctcttctgggccaaacactttgttggtggtatc |
32709901 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 88 - 154
Target Start/End: Complemental strand, 32629110 - 32629044
Alignment:
| Q |
88 |
cacatgaatggaggtgttggagaagcaagctatgcaaacaactccttagttcaggtattttatacat |
154 |
Q |
| |
|
|||||||||||||| ||||||||| | |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32629110 |
cacatgaatggaggcgttggagaaaccagctatgcaaacaactccttagttcaggtattttatacat |
32629044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 309 - 361
Target Start/End: Complemental strand, 7298174 - 7298122
Alignment:
| Q |
309 |
gcaattgcagacttgggttgctcttctgggccaaacactttgtttgtggtatc |
361 |
Q |
| |
|
||||||||||| || ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
7298174 |
gcaattgcagatttaggttgttcttctggaccaaacactttgtttgtggtatc |
7298122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 86 - 131
Target Start/End: Complemental strand, 7298547 - 7298502
Alignment:
| Q |
86 |
tgcacatgaatggaggtgttggagaagcaagctatgcaaacaactc |
131 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||||| ||||| |
|
|
| T |
7298547 |
tgcacatgaatggaggtgatggagaaacaagctatgcaaaaaactc |
7298502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 303 - 352
Target Start/End: Complemental strand, 32704249 - 32704200
Alignment:
| Q |
303 |
agcttagcaattgcagacttgggttgctcttctgggccaaacactttgtt |
352 |
Q |
| |
|
||||| ||||||||||| ||||||||||||| ||| |||||||||||||| |
|
|
| T |
32704249 |
agcttggcaattgcagatttgggttgctcttatggaccaaacactttgtt |
32704200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 310 - 352
Target Start/End: Complemental strand, 32628014 - 32627972
Alignment:
| Q |
310 |
caattgcagacttgggttgctcttctgggccaaacactttgtt |
352 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
32628014 |
caattgcagacttaggttgctcttctggatcaaacactttgtt |
32627972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 90 - 146
Target Start/End: Complemental strand, 5812225 - 5812169
Alignment:
| Q |
90 |
catgaatggaggtgttggagaagcaagctatgcaaacaactccttagttcaggtatt |
146 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
5812225 |
catgaatggaagtgttgaagaagcaagctatgcaaacaactccttgcttcaggtatt |
5812169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 303 - 349
Target Start/End: Complemental strand, 5811666 - 5811620
Alignment:
| Q |
303 |
agcttagcaattgcagacttgggttgctcttctgggccaaacacttt |
349 |
Q |
| |
|
||||| ||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
5811666 |
agcttggcaattgcagacttgggttgctcttttggaccaaacacttt |
5811620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 88 - 151
Target Start/End: Complemental strand, 27737676 - 27737613
Alignment:
| Q |
88 |
cacatgaatggaggtgttggagaagcaagctatgcaaacaactccttagttcaggtattttata |
151 |
Q |
| |
|
|||||||||||| | ||| |||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
27737676 |
cacatgaatggaagccttgcagaagcaagctatgcaaacaactccttacttcaggtatattata |
27737613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 303 - 361
Target Start/End: Complemental strand, 27736985 - 27736927
Alignment:
| Q |
303 |
agcttagcaattgcagacttgggttgctcttctgggccaaacactttgtttgtggtatc |
361 |
Q |
| |
|
||||| ||||||||||||||||||||||||| ||||||||||||| |||| ||| |||| |
|
|
| T |
27736985 |
agcttggcaattgcagacttgggttgctcttttgggccaaacactatgttggtgatatc |
27736927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000009; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 312 - 364
Target Start/End: Original strand, 8028972 - 8029024
Alignment:
| Q |
312 |
attgcagacttgggttgctcttctgggccaaacactttgtttgtggtatctga |
364 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
8028972 |
attgcagatttgggttgttcttctgggccaaacactttgttggtgatatctga |
8029024 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 78 - 144
Target Start/End: Original strand, 8028707 - 8028773
Alignment:
| Q |
78 |
acaagtattgcacatgaatggaggtgttggagaagcaagctatgcaaacaactccttagttcaggta |
144 |
Q |
| |
|
||||||| | |||||||||||||| |||||||| |||||||| |||| ||||||||| |||||||| |
|
|
| T |
8028707 |
acaagtactccacatgaatggaggaattggagaaacaagctattcaaataactccttacttcaggta |
8028773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 88 - 143
Target Start/End: Complemental strand, 21945119 - 21945064
Alignment:
| Q |
88 |
cacatgaatggaggtgttggagaagcaagctatgcaaacaactccttagttcaggt |
143 |
Q |
| |
|
|||||||||||||| || | ||||||||||||||||||||||||| | ||||||| |
|
|
| T |
21945119 |
cacatgaatggaggcgtcgatgaagcaagctatgcaaacaactcctcacttcaggt |
21945064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University