View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9262_low_44 (Length: 369)
Name: NF9262_low_44
Description: NF9262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9262_low_44 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 191; Significance: 1e-103; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 12 - 353
Target Start/End: Original strand, 40562529 - 40562852
Alignment:
| Q |
12 |
ttggtgtttaagtgggaacggtgttgatttgatatgcatgagaaatgaacggtggatttaacatttgtgacgtatgaagttgtagtaaccatattggnnn |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40562529 |
ttggtgtttaagtgggaacggtgttgatttgatatgcatgagaaatgaacggtggatttaacatttgtgacgtatgaagttgtagtaaccatattggaaa |
40562628 |
T |
 |
| Q |
112 |
nnnnntgaggtgaaggtgtttgaagaagagaaaggagggagaagaatgaaataagtctcaagttgagttattttgatattgatgggatccttgattatta |
211 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
40562629 |
aaaaatgaggtgaaggt---tgaagaagagaaaggagggagaagaatgaaataagtctcaagttgagttattttgatattgatgggatccttga---tta |
40562722 |
T |
 |
| Q |
212 |
ttatatctatctatctatataggttcgttctatggtgttgatattcaactaat--------gtctcttttgcttgacattttttaatgtgtttatttaga |
303 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
40562723 |
ttat-------------tata-------tctatggtgttgatattcaactaatagaaatttgtctgttttgcttgacattttttaatgtgtttatttaga |
40562802 |
T |
 |
| Q |
304 |
tattttcttataaaggaaatcaaataaaaatgagactaaattatagatga |
353 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
40562803 |
tattttcttataaaggaaatcaaataaaaattagactaaattatagatga |
40562852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University