View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9262_low_48 (Length: 336)
Name: NF9262_low_48
Description: NF9262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9262_low_48 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 156; Significance: 7e-83; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 156; E-Value: 7e-83
Query Start/End: Original strand, 148 - 319
Target Start/End: Original strand, 22848378 - 22848549
Alignment:
| Q |
148 |
atataaaaagaaacaaaatcctagaatagcaagcaattgatcgttttccagtttccactctgcctcccatagagcttttttctgaatctggatctggaca |
247 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
22848378 |
atataaaaagaaccaaaatcctagaatagcaagcaattgatcgttttccagtttccactctgcctcccatagagcttttttctggatctggatctggaca |
22848477 |
T |
|
| Q |
248 |
gcaacaacatttacaacgctgagtcactcactcacctctgaaatttatctctttgcaggtatgatatgaatc |
319 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
22848478 |
gcaacaacagttacaacgctgagtcactcactcacctctgaaatttatctctttgccggtatgatatgaatc |
22848549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 1 - 108
Target Start/End: Original strand, 22848275 - 22848379
Alignment:
| Q |
1 |
gcgacactgcaaagacacggtttggggacacggctgagaaacaaaacgatttaaccccnnnnnnnnnnnnncagcagaactttgggcttctttcacaacg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
22848275 |
gcgacactgcaaagacacggtttggggacacggctgagaaacaaaacgatttaacccc---aaaaaaaaaacagcagaactttgggcttctttcacaacg |
22848371 |
T |
|
| Q |
101 |
actgctat |
108 |
Q |
| |
|
|||||||| |
|
|
| T |
22848372 |
actgctat |
22848379 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University