View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9262_low_58 (Length: 315)
Name: NF9262_low_58
Description: NF9262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9262_low_58 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 18 - 298
Target Start/End: Complemental strand, 26806679 - 26806400
Alignment:
| Q |
18 |
catttttagagtttgttggataggataatgggaaattaagagaaattataattttaagcaattcgaaagcttcaattccattcannnnnnnnnnnnnnnn |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
26806679 |
catttttagagtttgttggataggataatgggaaattaagagaaattataattttaagcaattcgaaagcttcaattc-attcatttttaatttttttt- |
26806582 |
T |
 |
| Q |
118 |
catttgaatagagtaataaaattctccattctcaaaatagggactaatttacaaaatttgataatctaggtttgttaattttgaaaaaa-tatataagga |
216 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
26806581 |
catttgaatagagtaataaaattctcgattctcaaaatagggactaatttacaaaatttgataatctaggtttgttaattttgaaaaaaatatataagga |
26806482 |
T |
 |
| Q |
217 |
ccaatttggaattttttaaaagtatttattggaaaactttgtgaatttataaaatacagggaccatctccaaaatttatact |
298 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26806481 |
ccaatttgggattttttagaagtatttattggaaaactttgtaaatttataaaatacagggaccatctccaaaatttatact |
26806400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University