View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9262_low_60 (Length: 292)
Name: NF9262_low_60
Description: NF9262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9262_low_60 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 1 - 279
Target Start/End: Original strand, 42634118 - 42634397
Alignment:
| Q |
1 |
ttgagatactgataccgctcatttacttttaaatattgaaattgttaggcaaggaaggcactacgagcattaaaagggctggtgaaactccaggcactgg |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42634118 |
ttgagatactgatactgctcatttacttttaaatattgaaattgttaggcaaggaaggcactacgagcattaaaagggctggtgaaactccaggcactgg |
42634217 |
T |
 |
| Q |
101 |
tgagaggtcatattgagaggaaacgaacagcagagtggctcaaaagaatgcaatcac-tttacgagcacaggcacgatttaatgcagcacgcaccatgca |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
42634218 |
tgagaggtcatattgagaggaaacgaacagcagagtggctcaaaagaatgcaatcacttttacgggcacaggcacgatttaatgcagcacgcaccatgca |
42634317 |
T |
 |
| Q |
200 |
aacctcacatttgaatgcaaaatcatctactctccacctctatgtaagtgtaattatgaattgctcttcctcttttttct |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42634318 |
aacctcacatttgaatgcaaaatcatctactctccacctctatgtaagtgtaattatgaattgctcttcctcttttttct |
42634397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University