View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9262_low_68 (Length: 259)
Name: NF9262_low_68
Description: NF9262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9262_low_68 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 99 - 246
Target Start/End: Complemental strand, 39023172 - 39023006
Alignment:
| Q |
99 |
taaatgcatgtatatctatcaaattgtttttgttatgcgatctccaaatagtaaatgttccctctctt-------------------actattatcacaa |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
39023172 |
taaatgcatgtatatctatcaaattgtttttgttatgcgatctccaaatagtaaatgttccctctcttcctagagcatctatctcttactattatcacaa |
39023073 |
T |
 |
| Q |
180 |
tatttttcattacatcttatattgcatttctttcatttttataaataaaatgctaaaaactccacag |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39023072 |
tatttttcattacatcttatattgcatttctttcatttttataaataaaatgctaaaaactcaacag |
39023006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 15 - 115
Target Start/End: Complemental strand, 39023409 - 39023309
Alignment:
| Q |
15 |
attttttagatgaattgcatgcaagtagttaatgatgtgtttaatgttaagtttaagttaaaattatacagtatggatttttagtaaatgcatgtatatc |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| | |||||||| |||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
39023409 |
attttttagatgaattgcatgcaagtagttaatgatgtgctaaatgttaattttaagttaaaattataccttatggatttttagtaaatgcatgtatatc |
39023310 |
T |
 |
| Q |
115 |
t |
115 |
Q |
| |
|
| |
|
|
| T |
39023309 |
t |
39023309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University