View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9262_low_72 (Length: 239)
Name: NF9262_low_72
Description: NF9262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9262_low_72 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 4 - 224
Target Start/End: Complemental strand, 44143547 - 44143327
Alignment:
| Q |
4 |
gttgttaaattatttgtcaatagtaattgctagaaaagttatttattttggtttctgaaatagtatctgacagtttatctaaaatttgagttatatttag |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44143547 |
gttgttaaattatttgtcaatagtaattgctagaaaagttatttattttggtttctgaaatagtatctgacagtttatctaaaatttgagttatatttag |
44143448 |
T |
 |
| Q |
104 |
atgtcagttgacgacttagctattaatactcaactacttatgccaaatgttggttcttttaataggattcagttcaactgttctttaagatgatgtggca |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44143447 |
atgtcagttgacgacttagctattaatactcaactacttatgccaaatgttggttcttttaataggattcagttcaactgttctttaagatgatgtggca |
44143348 |
T |
 |
| Q |
204 |
atgtagactccgctaagagat |
224 |
Q |
| |
|
||||||||||| ||||||||| |
|
|
| T |
44143347 |
atgtagactccactaagagat |
44143327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 165 - 217
Target Start/End: Complemental strand, 50063712 - 50063660
Alignment:
| Q |
165 |
ataggattcagttcaactgttctttaagatgatgtggcaatgtagactccgct |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50063712 |
ataggattcagttcaactgttctttaagatgatgtggcaatgtagactccgct |
50063660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University