View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9263_low_25 (Length: 328)
Name: NF9263_low_25
Description: NF9263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9263_low_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 8e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 8e-95
Query Start/End: Original strand, 114 - 309
Target Start/End: Original strand, 50550327 - 50550522
Alignment:
| Q |
114 |
gtgtgcgttgatctactttgattggggtgccaatggcagaagctagcaccagaagaacgctttcatcatagtaaatcaagctcatccctgggaaacgaac |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
50550327 |
gtgtgcgttgatctactttgattggggtgccaatggcagaagctagcaccagaagaacgctttcatcatagtaaatcaagctcatgcctgggaaacgaac |
50550426 |
T |
 |
| Q |
214 |
ccaaaccatcgtcttttcaatcttagcagtggatgatacgaactccgggctccatttagcaacagcaaggtagtgatcaaagatcatccacggacc |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||| |||||||||||||||||| |||| |
|
|
| T |
50550427 |
ccaaaccatcgtcttttcaatcttagcagtggatgatacgaactccaggctccatttagcaacagtaaggtaatgatcaaagatcatccacagacc |
50550522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University