View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9263_low_33 (Length: 299)
Name: NF9263_low_33
Description: NF9263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9263_low_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 1 - 280
Target Start/End: Complemental strand, 13951980 - 13951701
Alignment:
| Q |
1 |
gagaaatagatggacttgatgaggaattcaatatcatgtaggtgtagatggataggtagagtagagatagatgctagttttaaagcaaggaaatagaaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
13951980 |
gagaaatagatggacttgatgaggaattcaacatcatgtaggtgtagatggataggtagagtagagatagatgctagttgtacagcaaggaaatagaaaa |
13951881 |
T |
 |
| Q |
101 |
attggtaggaacaaccactttgtgaaaattgtaaagataaatgtaaatgtggcatcatcatagattaacactgctttcattacgagtagcctgtgtttgg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
13951880 |
attggtaggaacaaccactttgtgaaaattgtaaagataaatgtaaatgtggcatcatcatagattaacactgctttcattactagtagcctgtgtttgg |
13951781 |
T |
 |
| Q |
201 |
ttcggcttttttaacgggcaaacaaaaacatgcataaccagttacataccaccagatgctcttcacagagttaacttaac |
280 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13951780 |
ttcggcttttttaacgggcaaacaaacacatgcataaccagttacataccaccagatgctcttcacagagttaacttaac |
13951701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University