View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9264A_low_130 (Length: 331)
Name: NF9264A_low_130
Description: NF9264A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9264A_low_130 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 5 - 257
Target Start/End: Complemental strand, 13669681 - 13669429
Alignment:
| Q |
5 |
caatatcattgttaacagcagcaagcaatggaatagctgtcaatcttctcactgacttgaacttgaaaacatcaatcattgatttccattgcatcatgtt |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13669681 |
caatatcattgttaacagcagcaagcaatggaatagctgttaatcttctcactgacttgaacttgaaaacatcaatcattgatttccattgcatcatgtt |
13669582 |
T |
 |
| Q |
105 |
actttccttccaacctaattttccctccaccggtggtgaattctccgatgagtacgaggagaaactgctgcttccactattgtctgactctgttcctgaa |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13669581 |
actttccttccaacctaattttccctccaccggtggtgaattctccgatgagtacgaggagaaactgctgcttccactattgtctgactctgttcctgaa |
13669482 |
T |
 |
| Q |
205 |
acaggggcatctagtattgctcttggtgatgcttcatcgtcgcttgaaaactg |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13669481 |
acaggggcatctagtattgctcttggtgatgcttcatcgtcgcttgaaaactg |
13669429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University