View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9264A_low_151 (Length: 319)
Name: NF9264A_low_151
Description: NF9264A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9264A_low_151 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 36 - 319
Target Start/End: Original strand, 9283091 - 9283374
Alignment:
| Q |
36 |
tattatggtaagatattaatgagctatgtgcacaagtggtagagtgagtattttatttggcagaggaatgcaagttagcaaatgttcctaagaggatatc |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
9283091 |
tattatggtaagatattaatgagctatgtgcacaagtggtagagtgagcattttatttgacagaggaatgtaagttagcaaatgttcctaagagcatatc |
9283190 |
T |
|
| Q |
136 |
aattttgatcagtacgcttcgatcacaattgtttcaatggtgatgcctaattctactgctgaaccagcaagccaacttctcaatgagcctcacactgccg |
235 |
Q |
| |
|
|||||||| || ||||||||||||||||| |||||||||||||| |||||||||| || ||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
9283191 |
aattttgaccaatacgcttcgatcacaatagtttcaatggtgatacctaattctattgttgaaccagcaagccaacttctcaatgagcctcaaactgccg |
9283290 |
T |
|
| Q |
236 |
gctcaaatgtaatattattggctcttttttgagtcatctgaacataacatggacatgtatgtgcctgtgagatgatgagggtga |
319 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
9283291 |
gctcaaatataatattaatggctcttttttgagtcatctgaacataacatggatatgtatgtgcctgtgagatgatgagggtga |
9283374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 10 - 84
Target Start/End: Original strand, 22956259 - 22956333
Alignment:
| Q |
10 |
gagtatttggaagcaaaagatccttatattatggtaagatattaatgagctatgtgcacaagtggtagagtgagt |
84 |
Q |
| |
|
||||||||||||||| | || ||||| || |||| ||||| ||||||||||||| |||||||||||||| |||| |
|
|
| T |
22956259 |
gagtatttggaagcacatgaaccttaaatcatggcaagatgttaatgagctatgcacacaagtggtagagcgagt |
22956333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University