View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9264A_low_164 (Length: 309)
Name: NF9264A_low_164
Description: NF9264A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9264A_low_164 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 145; Significance: 3e-76; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 12 - 156
Target Start/End: Complemental strand, 7625354 - 7625210
Alignment:
| Q |
12 |
gatatgaacttacttcgtttttgaacaagttagcaccaccaaattgcaaagcatgctctcctatgtctgctaaattcataaaaccaatacccagctagca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7625354 |
gatatgaacttacttcgtttttgaacaagttagcaccaccaaattgcaaagcatgctctcctatgtctgctaaattcataaaaccaatacccagctagca |
7625255 |
T |
|
| Q |
112 |
aaaaacatcattccatatattgccaaagaaatcacaatctagaaa |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7625254 |
aaaaacatcattccatatattgccaaagaaatcacaatctagaaa |
7625210 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 192 - 300
Target Start/End: Complemental strand, 7625203 - 7625095
Alignment:
| Q |
192 |
cccagacaatgcaaagaagtagaacttaccactccatgactcaagagacaatccttattcaattgatnnnnnnnnnttacgaacgttatcgagcaaagtc |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||| ||||||||| ||||||||| |
|
|
| T |
7625203 |
cccagacaatgcaaagaagtagaacttaccactccatgactcaagagacaatcctaattcaattgataaaaaaaatttacaaacgttatcaagcaaagtc |
7625104 |
T |
|
| Q |
292 |
tgctagaaa |
300 |
Q |
| |
|
|||| |||| |
|
|
| T |
7625103 |
tgctggaaa |
7625095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University