View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9264A_low_268 (Length: 264)
Name: NF9264A_low_268
Description: NF9264A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9264A_low_268 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 5 - 258
Target Start/End: Complemental strand, 4591903 - 4591647
Alignment:
| Q |
5 |
aatactttgcagagattaattgctgagcactgacggtgtaaagcttttttacgcgtagaatcttatcaaatcaccccatgtttat---attttgagatat |
101 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
4591903 |
aatactttgcagagattaattgctgaaaactgacggtgtaaagcttttttacgcgttgaatcttatcagatcaccccatgtttattatattttgagatat |
4591804 |
T |
|
| Q |
102 |
ttaaggaagtaacctaaacaattggcattatgatatggcttgattggatgcatgtataaaacagttttacaaccctcgttaaaagacaagggacagatat |
201 |
Q |
| |
|
|| ||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
4591803 |
ttgaggaagtaacctaaacaattgccattatgacatggcttgattggatgcatgtataaaacagttttacaaccctcgttaaaagacaagggagagatat |
4591704 |
T |
|
| Q |
202 |
tgtcttgtgcaaattcaaatacttaatattttcatgatgtgaaaatttggactgatt |
258 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
4591703 |
tgtcttgtgcaaattcaaatatttaatattttcatgatgtgaaaatttggactgatt |
4591647 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University