View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9264A_low_306 (Length: 252)
Name: NF9264A_low_306
Description: NF9264A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9264A_low_306 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 252
Target Start/End: Original strand, 2281765 - 2282015
Alignment:
| Q |
1 |
aatatgtttatccctaaaaattaaactacctccaccacttatcgaagaacattgatatttctctcacnnnnnnnnnnataaaaattatttctatcaattg |
100 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
2281765 |
aatatgtttaaccctaaaaattaaactacctccaccacttatcgaagaacattgatatttctctcacttttttttt-ataaacattatttctatcaattg |
2281863 |
T |
|
| Q |
101 |
aatagttatgaattgagtattaatagtactaaattaaacttaataaaatgatttaaggaaggttggaggttagatgcatggataatgcataaatttaact |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
2281864 |
aatagttatgaattgagtattaatagtactaaattaaacttgataaaatgatttaaggagggttcgaggttagatgcatggatgatgcataaatttaact |
2281963 |
T |
|
| Q |
201 |
aactaaccaatctttttctctatcaacttgatcaaactcaattccattgtca |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
2281964 |
aactaaccaatctttttctctatcaacttgatcaaactcaattcccttgtca |
2282015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University