View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9264A_low_308 (Length: 251)

Name: NF9264A_low_308
Description: NF9264A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9264A_low_308
NF9264A_low_308
[»] chr2 (1 HSPs)
chr2 (7-41)||(44111436-44111470)


Alignment Details
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 7 - 41
Target Start/End: Original strand, 44111436 - 44111470
Alignment:
7 gaaacaaagaactagaaactaatcaaccaaacagg 41  Q
    |||||||||||| ||||||||||||||||||||||    
44111436 gaaacaaagaacaagaaactaatcaaccaaacagg 44111470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University