View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9264A_low_312 (Length: 251)
Name: NF9264A_low_312
Description: NF9264A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9264A_low_312 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 19 - 146
Target Start/End: Complemental strand, 29003015 - 29002888
Alignment:
| Q |
19 |
atatgttgccaacgacatggttatatagtagtacattgattgattaggaattaacttgatttggcatgtaaatatgtagtggcatgacacttaatttggc |
118 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29003015 |
atatgttcccaacgacatggttatatagtagtatattgattgattaggaattaacttgatttggcatgtaaatatgtagtggcatgacacttaatttggc |
29002916 |
T |
|
| Q |
119 |
atggaacaaattaattcatgcaactact |
146 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
29002915 |
atggaacaaattaattcatgcaactact |
29002888 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 143 - 231
Target Start/End: Complemental strand, 29002742 - 29002654
Alignment:
| Q |
143 |
tactacctttgttcttgaaactctagtagtattagtatttgaaaagaaattttgtttataagcttattttaactatttttacttttagt |
231 |
Q |
| |
|
|||| ||||||||||| ||||||||||| |||||||||||||||| |||||||| | |||||||||||||||||| || || ||||||| |
|
|
| T |
29002742 |
tactgcctttgttcttaaaactctagtaatattagtatttgaaaataaattttgctcataagcttattttaactacttctaattttagt |
29002654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University