View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9264A_low_313 (Length: 251)
Name: NF9264A_low_313
Description: NF9264A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9264A_low_313 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 45200611 - 45200841
Alignment:
| Q |
1 |
tcaacaccacaccgacaattgattattgttgtcgacatgtcaatgtctgttattcatagattgtaaaaaataaaatgtaacaaactgtgagtttgtcaaa |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| ||||| |
|
|
| T |
45200611 |
tcaacaccacaccgacaaatgattattgttgtcgacatgtcaatgtctgttattcatagattgtaacaaataaaatgtaacaaacggtgagtttttcaaa |
45200710 |
T |
|
| Q |
101 |
atcacggtgacatcatgattttgttgaagctatgtatggcttttaccaaaatcacaatgactcatcgtgatcctaatgctacgcttcaccgtcaatcaaa |
200 |
Q |
| |
|
||||| ||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
45200711 |
atcacagtgacattatgattttgttgaagctaagtatggcttttaccaaaatcacaatgactcatcgtgattctaaagctacgcttcaccgtcaatcaaa |
45200810 |
T |
|
| Q |
201 |
acattcacaaagtagaaaaacttacgaggtc |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
45200811 |
acattcacaaagtagaaaaacttacgaggtc |
45200841 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 87 - 133
Target Start/End: Original strand, 7873062 - 7873108
Alignment:
| Q |
87 |
gtgagtttgtcaaaatcacggtgacatcatgattttgttgaagctat |
133 |
Q |
| |
|
||||||||| ||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
7873062 |
gtgagtttgataaaattacggtgacaccatgattttgttgaagctat |
7873108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 88 - 129
Target Start/End: Original strand, 23585692 - 23585733
Alignment:
| Q |
88 |
tgagtttgtcaaaatcacggtgacatcatgattttgttgaag |
129 |
Q |
| |
|
|||||||| ||||||||| |||||| |||||||||||||||| |
|
|
| T |
23585692 |
tgagtttgacaaaatcacagtgacaacatgattttgttgaag |
23585733 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 87 - 128
Target Start/End: Complemental strand, 27870987 - 27870946
Alignment:
| Q |
87 |
gtgagtttgtcaaaatcacggtgacatcatgattttgttgaa |
128 |
Q |
| |
|
||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
27870987 |
gtgagtttgataaaatcacggtgacaccatgattttgttgaa |
27870946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University