View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9264A_low_328 (Length: 250)
Name: NF9264A_low_328
Description: NF9264A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9264A_low_328 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 48484382 - 48484626
Alignment:
| Q |
1 |
acctgatcatgtacaagaaatggaagtttcagtatgtaaaagttcatatgaaatgcatgcttaccttgcgaaaaggaaaacacctgtttctgatttaact |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
48484382 |
acctgatcatgtacaagaaatggaagtttcagtatgtaaaagttcatatgaaatgcatgcttaccttgcaaaaaggaaaacacctgtttctgatttaact |
48484481 |
T |
 |
| Q |
101 |
tcatgggaattccggcttggggattgtgttccgtgatctgaagaaatttgttttgttatttcaaaaatgagaaagaagcgcagaagtattatggagatat |
200 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
48484482 |
tcatgggaattccagcttggggattgtgttccgtgatctgaagaaatttgttttgttatttcaaaaatgagaaagaagcgcagaaatattatggagatat |
48484581 |
T |
 |
| Q |
201 |
gaagacacggtacacacaacactacaggactatatctttgatact |
245 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
48484582 |
gaagacacggtacacacaacactgcaggactatatctttgatact |
48484626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University