View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9264A_low_337 (Length: 249)
Name: NF9264A_low_337
Description: NF9264A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9264A_low_337 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 34348961 - 34349195
Alignment:
| Q |
1 |
gtcaataaacgagttcttactttatttcaaagattattattgcatatgatacagtttggtggctttgagacttcattgtcattcactgtggctgcatttg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| || |
|
|
| T |
34348961 |
gtcaataaacgagttcttactttatttcaaagattattattgcatatgatacagtttggtggctttgagacttcattgtcattcattgtggctgcatgtg |
34349060 |
T |
 |
| Q |
101 |
tgtttattttcagtggt---atcatcatgccatgatggcttagaaaaacactgcacctatagttgttgatttttcatattgagtgtttgaaagagagtgt |
197 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
34349061 |
tgtttattttcagtggtatcatcatcatgccatgatggcttagaaaaacactgcacctgtagttgttgatttttcatattgagtgttcgaaagagagtgt |
34349160 |
T |
 |
| Q |
198 |
cccgtagtgtgtgcagctagcaattttcttgatgt |
232 |
Q |
| |
|
| | |||||||||| ||||||||||||||| |||| |
|
|
| T |
34349161 |
cacatagtgtgtgctgctagcaattttcttaatgt |
34349195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University