View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9264A_low_358 (Length: 247)
Name: NF9264A_low_358
Description: NF9264A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9264A_low_358 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 11 - 240
Target Start/End: Original strand, 3015947 - 3016176
Alignment:
| Q |
11 |
gaattgtaataatagtgagaacaagttcaaacatgacaacattgtaatagaaagttgacacaagatttctgtaatcttgatcagcnnnnnnncccccttc |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
3015947 |
gaattgtaataatagtgagaacaagttcaaacatgacaacattgtaatagaaagttgacacaagatttctgtaatcttgatcagctttttttcccccttc |
3016046 |
T |
 |
| Q |
111 |
aattttctctttttattcctcaagcctgtttacttacaatggtagaagaatattaatatgtaagatcttaaaaatgataatctaactctaagacaatcac |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||| ||||||| ||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
3016047 |
aattttctctttttattcctcaagcctgtttacttacaacggtagacgaatattgatatgtatgatcttaaaaatgataatctaactctaagacaatcat |
3016146 |
T |
 |
| Q |
211 |
aaaatgctgacaaatccatcatctatgata |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
3016147 |
aaaatgctgacaaatccatcatctatgata |
3016176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University