View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9264A_low_368 (Length: 245)
Name: NF9264A_low_368
Description: NF9264A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9264A_low_368 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 2e-92; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 66 - 237
Target Start/End: Complemental strand, 22371095 - 22370924
Alignment:
| Q |
66 |
tgacgttcaattactgtgaattggctcttgatactaaaaggtggttggaacgacaatgtggcgactacgtgacggtgctgacatccttgcattggctaga |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22371095 |
tgacgttcaattactgtgaattggctcttgatactaaaaggtggttggaacgacaatgtggcgactacgtgacggtgctgacatccttgcattggctaga |
22370996 |
T |
|
| Q |
166 |
gcatttgcactaaaggattgcaacggcaaccagtacggttcccatctttttcatggccaaacttcaacacca |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22370995 |
gcatttgcactaaaggattgcaacggcaaccagtacggttcccatctttttcatggccaaacttcaacacca |
22370924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 22371216 - 22371155
Alignment:
| Q |
1 |
accatggcaaaaacttaaaaaacgaacaggagtactgtatggcacagtttgaggcaccttct |
62 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22371216 |
accatggcagaaacttaaaaaacgaacaggagtactgtatggcacagtttgaggcaccttct |
22371155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University