View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9264A_low_376 (Length: 244)
Name: NF9264A_low_376
Description: NF9264A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9264A_low_376 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 133; Significance: 3e-69; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 82 - 230
Target Start/End: Original strand, 18134424 - 18134572
Alignment:
| Q |
82 |
ctgttatgagttatgtcatgaaccaactgtcccagaaagttaagatatttggttaatgttcgtgaacggtttttcttcttttaatccttggatgttatat |
181 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18134424 |
ctgttatgagttatgtcatgaaccaactatcccagaaagttaagatatttggttaacgttcgtgaacggtttttcttcttttaatccttggatgttatat |
18134523 |
T |
|
| Q |
182 |
atgcatgttatcgggaaactttgaatgtttgtatgtgtgttcatatcag |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
18134524 |
atgcatgttatcgggaaactttgaatgtttgtatgtgtgtgcatctcag |
18134572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 22 - 77
Target Start/End: Original strand, 18133695 - 18133750
Alignment:
| Q |
22 |
ttataatactagttattatggcgtgccagaagatggaccgtctcagccttctattt |
77 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18133695 |
ttataatactaattattatggcgtgccagaagatggaccgtctcagccttctattt |
18133750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 48; Significance: 1e-18; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 82 - 215
Target Start/End: Original strand, 49879849 - 49879979
Alignment:
| Q |
82 |
ctgttatgagttatgtcatgaaccaactgtcccagaaagttaagatatttggttaatgttcgtgaacggtttttcttcttttaatccttggatgttatat |
181 |
Q |
| |
|
||||||||| |||||||||||||||||| | ||| || || ||| ||||||||||| | || |||| |||| |||||||||||| |||||||||| | |
|
|
| T |
49879849 |
ctgttatgatttatgtcatgaaccaactattccaaaaggtaaagctatttggttaaagctcatgaatggtt---cttcttttaatcattggatgttacgt |
49879945 |
T |
|
| Q |
182 |
atgcatgttatcgggaaactttgaatgtttgtat |
215 |
Q |
| |
|
||||||||||||| |||| |||||||| ||||| |
|
|
| T |
49879946 |
atgcatgttatcgtgaaatattgaatgtctgtat |
49879979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 82 - 177
Target Start/End: Original strand, 46520631 - 46520723
Alignment:
| Q |
82 |
ctgttatgagttatgtcatgaaccaactgtcccagaaagttaagatatttggttaatgttcgtgaacggtttttcttcttttaatccttggatgtt |
177 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||||||| | ||||||||| | || |||| || |||||||||||||| ||||||||| |
|
|
| T |
46520631 |
ctgttatgagttatgtcatgaaccaactatcccagagagttaagctttttggttaaagctcatgaatgg---ttcttcttttaatctttggatgtt |
46520723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 165 - 218
Target Start/End: Original strand, 6618797 - 6618850
Alignment:
| Q |
165 |
atccttggatgttatatatgcatgttatcgggaaactttgaatgtttgtatgtg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||||||| ||| |||||||| |
|
|
| T |
6618797 |
atccttggatgttatatatgcatgttattgtaaaactttgagtgtatgtatgtg |
6618850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 218
Target Start/End: Complemental strand, 6619755 - 6619705
Alignment:
| Q |
168 |
cttggatgttatatatgcatgttatcgggaaactttgaatgtttgtatgtg |
218 |
Q |
| |
|
||||||||||||||||||||||||| | ||||||| | |||||||||||| |
|
|
| T |
6619755 |
cttggatgttatatatgcatgttattgtaaaactttaagtgtttgtatgtg |
6619705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University