View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9264A_low_381 (Length: 244)
Name: NF9264A_low_381
Description: NF9264A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9264A_low_381 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 2727939 - 2727694
Alignment:
| Q |
1 |
tttggtgtttatcctatggatacaaattggggagttgcattgcttgatcttttgggaaatttggcatttcctttgatattgcttggtactttactcctta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2727939 |
tttggtgtttatcctatggatacaaattggggagttgcaatacttgatcttttgggaaatttggcatttcctttgatattgcttggtactttactcctta |
2727840 |
T |
|
| Q |
101 |
ggacatctagcaataattctgttggtggccctaacttgccatttggattaggaaggtatgaattgtagcacgtgaaacttcc--ataactataaggatct |
198 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| | |
|
|
| T |
2727839 |
ggacatctagaaataattctgttggtggccctaacttgccatttggattaggaaggtatgaattgtagcacgtgaaacttccatataactataaggattt |
2727740 |
T |
|
| Q |
199 |
aattccgtatatgcactgatagtgtaaagattttttatactgtcag |
244 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
2727739 |
aattccgtatatgcaccgacagtgtaaagattttttatactgtcag |
2727694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University