View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9264A_low_382 (Length: 244)
Name: NF9264A_low_382
Description: NF9264A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9264A_low_382 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 19 - 244
Target Start/End: Complemental strand, 40925069 - 40924845
Alignment:
| Q |
19 |
cttatactgtttgcttccattgttgtggttgctattgcagtgatattgatcttggcatacagtccaactttcttaaaatggctgcgttcccctcccaaac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
40925069 |
cttatactgtttgcttccattgttgtggttgctattgcagtgatattgatcttggcatacggtccaactttcttaaaatggctgcgttcacctcccaaac |
40924970 |
T |
|
| Q |
119 |
caccacgggcagcggtggcccctttgcccctcactgagttgaacgtcgtgcaggcactaccgccggagcaagattgagtccaatgaagacacaatgcagg |
218 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40924969 |
caccacgggcagcggtggcacctttgcccctcactgagttg-acgtcgtgcaggcactaccgccggagcaagattgagtccaatgaagacacaatacagg |
40924871 |
T |
|
| Q |
219 |
taacaacaagtacatttctttgagga |
244 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
40924870 |
taacaacaagtacatttctttgagga |
40924845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University