View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9264A_low_383 (Length: 244)
Name: NF9264A_low_383
Description: NF9264A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9264A_low_383 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 12 - 224
Target Start/End: Original strand, 26933440 - 26933652
Alignment:
| Q |
12 |
agtatcatagaagataagtggcctaatattccaattattactgcacgcttctcaaccataaaaatctgtttagagtttatttgcacccccatcttaaaga |
111 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26933440 |
agtaccatagaagataagtggcctgatattccaattattactgcacgcttctcaaccataaaaatctgtttagagtttatttgcacccccatcttaaaga |
26933539 |
T |
 |
| Q |
112 |
aataaattatcattccaaattctgcaaatgttgaaagtatcattatgcttgctgttggaaataacatctcaaaacttgtgttgtctcgacccaaaaataa |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26933540 |
aataaattatcattccaaattctgcaaatgttgaaagtatcattatgcttgctgttggaaataacatctcaaaacttgtgttgtctcgacccaaaaataa |
26933639 |
T |
 |
| Q |
212 |
tgaacccactatg |
224 |
Q |
| |
|
|| |||||||||| |
|
|
| T |
26933640 |
tggacccactatg |
26933652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University