View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9264A_low_415 (Length: 240)
Name: NF9264A_low_415
Description: NF9264A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9264A_low_415 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 22 - 221
Target Start/End: Complemental strand, 33658493 - 33658300
Alignment:
| Q |
22 |
tgttttatttgtgttaggagaaacattagatcaaccaattaaaattggtattcaaacaatggatgtgtcgtgtggactgtggaaggtttgcaagaatata |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
33658493 |
tgttttatttgtgttaggagaaacattagatcaaccaattaaagttgatattcaaacaatggatgtgt-------attgtggaaggtttgcaagaatata |
33658401 |
T |
 |
| Q |
122 |
tgtcgagattgatttgaatctatcaattgttggccagttatggattcatgatagatag-ttcatagtcaaatatgaaggtctccatctgttgtgcaagaa |
220 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33658400 |
tgtcgagattgatttgaatctatcaattattggccagttatggattcatgatagatagtttcatagtcaaatatgaaggtctccatctgttgtgcaagaa |
33658301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University