View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9264A_low_422 (Length: 240)
Name: NF9264A_low_422
Description: NF9264A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9264A_low_422 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 19 - 219
Target Start/End: Complemental strand, 11527527 - 11527327
Alignment:
| Q |
19 |
tgttttctgctgtgcattctcaatttgaatttgcacctcatagattttgcatcgcaagacattgcaagcattttttgtaatacttgattgatgctttatt |
118 |
Q |
| |
|
|||||||| |||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11527527 |
tgttttcttctgttctttctcaatttgaatttgcacctcatagattttgcatcgcaagacattgcaagcattttttgtaatacttgattgatgctttatt |
11527428 |
T |
 |
| Q |
119 |
ttatacatgtataatgtaggaacgaaatatgtggacgcgtgtctgcaaatttgaaagagaaacagttcttttaagtttcaatatacagtgccctggttat |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
11527427 |
ttatacatgtataatgtaggaacgaaatatgtggatgcgtgtctgcaaatttgaaagagaaacagttctttcaagtttcaatatacagtgccctggttat |
11527328 |
T |
 |
| Q |
219 |
a |
219 |
Q |
| |
|
| |
|
|
| T |
11527327 |
a |
11527327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University