View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9264A_low_428 (Length: 239)
Name: NF9264A_low_428
Description: NF9264A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9264A_low_428 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 12 - 218
Target Start/End: Complemental strand, 15250448 - 15250241
Alignment:
| Q |
12 |
tttcgtgttttgagtttggtgttgttttaactttttagtgcatcatgctaacagtaaataa----tattaactatcatcactttgaaacaaaatagaacc |
107 |
Q |
| |
|
||||||| ||||||||| | ||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
15250448 |
tttcgtgctttgagtttagcgttgttttaactttttagtgcatcatgctaacagtaaataaataatattaactatca---ctttgaaacaaaatagaacc |
15250352 |
T |
|
| Q |
108 |
catgatacatttattaaattaaagtcattctgaccaatatcatctacaaccacatgtttcaaagaccacagaatccaccaggtcccccaaataacacaac |
207 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
15250351 |
catgacacatttattaaattaaagtaattctgaccaatatcatctacaaccacatgttttaaagaccacagaatccaccaggtccaccaaacaacacaac |
15250252 |
T |
|
| Q |
208 |
acgttgcaaat |
218 |
Q |
| |
|
||||||||||| |
|
|
| T |
15250251 |
acgttgcaaat |
15250241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University