View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9264A_low_443 (Length: 235)
Name: NF9264A_low_443
Description: NF9264A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9264A_low_443 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 93 - 235
Target Start/End: Complemental strand, 39243947 - 39243806
Alignment:
| Q |
93 |
gttaacttttgatgttggatccctacacagtttaaattacattacttttcccttgtcaactatttttaattaatcacgttttgagttcactcaatgttta |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||| || ||||||||||| |
|
|
| T |
39243947 |
gttaacttttgatgttggatccctacacagtttaaattacattactttttccttgtcaactatttttaattaatcacg-tttgaggtcgctcaatgttta |
39243849 |
T |
|
| Q |
193 |
ttttttcaacgacaggtcactcatggttgatcttgtggtatct |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39243848 |
ttttttcaacgacaggtcactcatggttgatcttgtggtatct |
39243806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 45 - 81
Target Start/End: Complemental strand, 39243998 - 39243962
Alignment:
| Q |
45 |
tcacctttagaaataataaattatctttgtatgtact |
81 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
39243998 |
tcacctctagaaataataaattaactttgtatgtact |
39243962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University