View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9264A_low_473 (Length: 230)
Name: NF9264A_low_473
Description: NF9264A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9264A_low_473 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 31 - 213
Target Start/End: Original strand, 40288838 - 40289020
Alignment:
| Q |
31 |
cagagaatgcagtcaagtacaaaactttcatatatctagctggttctgcttcagcagaagttattgctgattgtgcactttgtcctatggaggcagtcaa |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
40288838 |
cagagaatgcagtcaagtacaaaactttcatatatctagctggttctgcttcagcagaagttattgctgattgtgcactttgtcctatggaggctgtcaa |
40288937 |
T |
|
| Q |
131 |
agttcgtgtacaaactcagcctggctttgctcgtggtttgtctgatgggttacccaagtttgtcaaggctgatggtgtttctg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40288938 |
agttcgtgtacaaactcagcctggctttgctcgtggtttgtctgatgggttacccaagtttgtcaaggctgatggtgtttctg |
40289020 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University