View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9264A_low_508 (Length: 230)
Name: NF9264A_low_508
Description: NF9264A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9264A_low_508 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 3452002 - 3451778
Alignment:
| Q |
1 |
tgattacctcaacttgacgctgcaatgactgaacataatttataatttcatcaagcataagtgcttttccagtaacctacaaggaataattaataattca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3452002 |
tgattacctcaacttgacgctgcaatgactgaacataatttataatttcatcaagcataagtgcttttccagtaacctacaaggaataattaataattca |
3451903 |
T |
|
| Q |
101 |
taggcatagcccaattagtgaaaaagtacaaattttagtaacatgaaattaaaccaatttgttttgtattcttatttagtaacttttgaaagttttgctt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3451902 |
taggcatagcccaattagtgaaaaagtacaaattttagtaacatgaaattaaaccaatttgttttgtattctgatttagtaacttttgaaagttttgctt |
3451803 |
T |
|
| Q |
201 |
accttattgcaacctggtacaagat |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
3451802 |
accttattgcaacctggtacaagat |
3451778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 4 - 90
Target Start/End: Complemental strand, 18810863 - 18810777
Alignment:
| Q |
4 |
ttacctcaacttgacgctgcaatgactgaacataatttataatttcatcaagcataagtgcttttccagtaacctacaaggaataat |
90 |
Q |
| |
|
||||||||||||||||||||||||| || ||||| |||||||||||||||||||| |||||||||||||| ||||| |||||||||| |
|
|
| T |
18810863 |
ttacctcaacttgacgctgcaatgattgcacatagtttataatttcatcaagcatgagtgcttttccagtgacctagaaggaataat |
18810777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University