View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9264A_low_522 (Length: 229)
Name: NF9264A_low_522
Description: NF9264A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9264A_low_522 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 22 - 207
Target Start/End: Original strand, 23188295 - 23188482
Alignment:
| Q |
22 |
ataaaattcaaaaagaaaaccaaatttagtttcgtagctgatacaaattgcaaaaggtcatagcatcaaatat--atattaacaaaattcattttgaaaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
23188295 |
ataaaattcaaaaagaaaaccaaatttagtttcgtagctgatgcaaattgcaaaaggtcatagcatcaaatatatatattaacaaaattcattttgaaaa |
23188394 |
T |
 |
| Q |
120 |
attgtcaaactcttgtttctgcgttgtgcttttctcggttctatgaggtgcttcgtgcacaaacaatgtatagcagattgtgtcatct |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23188395 |
attgtcaaactcttgtttctgcgttgtgcttttctcggttctatgaggtgcttcgtgcacaaacaatgtatagcagattgtgtcatct |
23188482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University