View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9264A_low_524 (Length: 229)
Name: NF9264A_low_524
Description: NF9264A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9264A_low_524 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 21 - 213
Target Start/End: Complemental strand, 30492399 - 30492207
Alignment:
| Q |
21 |
attctaagaggacgaaggtaacttacagaccaagacatcatcactttttggcgtttctctggagacaacttagggtagctatggaaaaatgggaattttg |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30492399 |
attctaagaggacgaaggtaacttacagaccaagacagcatcactttttggcgtttctctggagacaacttagggtagctatggaaaaatgggaattttg |
30492300 |
T |
 |
| Q |
121 |
ttgagatacttgcaatgccacacaaaatcaatgtgccaaaccatgtagatagtggccataatgtcaacttcaataaccatgtacttggatgtt |
213 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30492299 |
ttgagatacttgcaataccacacaaaatcaatgtgccaaaccatgtagatagtagccataatgtcaacttcaataaccatgtacttggatgtt |
30492207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University